Tanmoy's genealogy

Genealogical research in Hindu India is paradoxically both very simple and difficult at the same time. Even though every major transition in life, birth, coming of age, marriage, and death, for example, is marked by a ceremony, these take place essentially in a family setting, and no centralized records are therefore kept. Even in the later period when records like birth certificates, high school graduation certificates, or passports exist, the birth date stated in them disagree with what is remembered by parents, celebrated as birthdays in the family (birthdays were often not celebrated at all), or written down in star charts etc. This probably resulted from parents' attempts to allow their children to get around retirement age rules or from a child being born just after the beginning of a school year so that they do not have to wait an extra year before joining school. However, such mismatch may sometimes indicate other problems in the records, or with people's memories.

Leaving aside the question of dates, most caste Hindu families, till recently, maintained a genealogical record of the names of the male ancestors, often with annotations when the joint families split and people moved out, but these carry no information about dates or events from when these people lived. On this page, I discuss a few topics related to discovering my genealogy in this setting:

The actual genealogy

Please follow the links to visit the genealogy on my father's and mother's side if you are not interested in discussions. You may also download it as a GEDCOM file, or view the same using a java applet.

Indices of all names appearing in the genealogy on my father's and mother's side are available. These are, however, often out of date.

Sources

The primary source of these genealogies are lists maintaind by the individual families. For my father's side, I got a handwritten document which has obviously been copied through the generations. The document is in Sanskrit written in Bengali script, though sometimes the spellings and grammar are incorrect. For my mother's side, I got a chart but I have not been able to track down the original document on which it was based.

The first treatises on Brahmin genealogy in Bengal were written in about the 15th (dhruvAnanda's mahA-vaMshAvali) and 16th/17th (nulo pancAnana's goSThi-kathA, vAcaSpati mishra's kula-rAmA) centuries (incidentally, of the non-brahmin ones, the vaidya ones are 17th century, the rest 17th/18th century). But, the interest in genealogy is much older: sambdandha viveka by bhava-deva bhaTTa written during the sena period (11th–12th century) mentions the tradition of prescribed exogamy rules that required the recitation by the bride and groom of the names of their direct ancestors along the male line for seven generations from their fathers and five generations from their mothers. The early part of the genealogy on my father's side overlaps with the traditional stories, but disagrees with them. Such disagreement is common in this early part, see here for an example of comparison of a few different sources.

The last part of my genealogy (overlapping with the generations where the list ends) is from my own experience. Some of the branches distantly related to me are gathered from my relatives closer to them: I may have misunderstood or misremembered some of their statements.

Short summary of the genealogy (tradition)

bhaTTAcAryya has been used as a family name only recently. Branches of my father's family have also used cakra-varttI, whereas my mother's family was caTTopAdhyAYa.

On my mother's side I can find the names of only the male ancestors for fifteen generations before my mother. At this time, a bhava-nAtha caTTopAdhyAYa of kAshyapa gotra lived in nala-ciD.A village in the nimana-dvipa region in bari-shAla. Two of his sons moved to brahmaNabAD.iYA and vaMshavATI, but my mother was descended from mAdhava who stayed in nala-ciD.A. My great grandfather, kAminikumAra, moved to West Bengal from barishAla.

On my father's side, family tradition has it that 30 generations before me, a brahmin by the name of veda-garbha came to Bengal from kAnya-kubja during the reign of AdishUra. (Such stories are actually quite common in different families. See the page describing one set of traditional stories about the origin of brahmins in Bengal.) He was of sAvarNa gotra and his five pravaras were bhRgu, cyAvaNa, ApluvAna, aurva, jAmadagni.

Eight generations after him, roSAkara brahmacArI started the kunda dynasty to which we belong. He was the teacher of the reigning king of Bengal, vallAla sena, who decided to separately recognize the high kulIna brahmins from the rest (See the page describing the traditional story of brahmin origin in bengal for more details). As it would be improper of the king to pass judgement on his own teacher, he decided to delegate the responsibility of drawing up this list to another brahmin in the court. By court intrigue, this resulted in our family not being classified as ‘kulina’. roSAkara was enraged and cursed the person responsible to be without descendants. The curse apparently worked.

Ten more generations later (i.e. 12 generations before me), of two brothers maGgalAcAryya and kRSNadAsa, the latter moved from shrImad vikrama-pura to the Doma-sAra village, whereas the sons of the former (raghu-nAtha, who might have been the first Bhattacharyya in the family, and gopI-nAtha, who might have been the first Chakravartti) moved with their deity to moSakAThI (or moD.AkAThI as it is later called), where they were brought by a king rAma-candra. If this person is the same as Raja Ramchandra of Bakla, famous for his association with the Baro Bhuiyans, this is in the early 1600's when Delhi was under the rule of Jehangir and just around when Khurram, later Shah Jahan, was amassing power as governor of Bengal. It is interesting to note that our family had land in bholA which adjoins Noakhali, and that entire region was called bhuluA before 1668 (the new canal was dug in 1660 AD to divert the dangerous waters of the Dakatia river), and the most famous stories of Ramchandra involve him defeating lakSmInAraYaNa of Bhulua.

Our family descended from this raghu-nAtha, though the genealogy mentions other branches of the family that dispersed at this time (i.e. 9 to 7 generations back from today): those settled in nau-dhulI (or dhUla), tAra-pAshA, shIkAra-pUra, bATA-jora, bAishI (or baishAD.i or rAishArI), harita-pura, ujira-pura, bhArtsAlA (or bharti-sAlA), caita-pura, and nabalA villages.

It is also around this time, some three to four hundred years back as we settled in these villages, that the genealogy starts using the titles Bhattacharyya and Chakravartti for the first time. In as few as a century and a half, most branches of the family regularly start using Bhattacharyya almost certainly as a last name and not merely as a title. This seems to be true even of most of those branches descended from people with a title of Chakravartti.

About one to three generations back from me, many of the branches in the family tree die out, and the rest migrate to different places. My grandfather yAminI and granduncle nalinI moved to Calcutta and we, their descendants, settled in various places.

Tradition versus history

The story of my father's family cannot be correct in the form stated. First, vallAla sena's guru was aniruddha of shANDilya gotra from campAhiTi. Second, the inscriptions of that period do not show any evidence that he started the kulina system. Third, he was a shaivaite, and our family, at least later, was shAkta, i.e., when we get dIkSA (initiation), it is a mantra (sacred words) belonging to kAli. (Our kuladevata is however nArAYaNa.)

However, vallAla sena's son lakSmaNa sena was a vaishnavite, and halAYudha of kAshyapa gotra was in his court and had a descendant shobhAkar who lived in AYdA (a few miles Southwest of Kalna) and was the guru of devivar who divided the kulinas into mels in 1482 AD. A story exactly similar to roSAkara is told about shobhAkara (ডাক দিয়ে কয় দেবীবর। নিষ্কুল শোভাকর॥ ডাক দিয়ে কয় শোভাকর। নির্বংশ দেবীবর॥), and shobhAkar's descendant rAma is known to have given the initiation to his own son viSNu siddhantavAgIsha, father of rAmadeva tarkavAgIsha and grandfather of vANeshvara vidyAlaGkAra who left the court of krISNachandra, ruler of krISNanagar, and wrote citrachampu in 1714 (or 1744) for chitrasena, king of varddhamAna, son of kIrtichandra, son of jagatrAYa, son of kriSNarAma who was contemporary of shobhAsiMha who in 1696 collaborated with the pAThAns from Orissa.

What is far more interesting is the relation of the sAvarNa gotra with the varmaNa dynasty. Not only did shyAmalavarmA's son give land grant to a brahmin of sAvarNa gotra who came from Uttar Pradesh, his own minister bhavadeva bhaTTa was from the same village. As shyAmalavarmA (East bengal) is associated with the origin of vaidika brahmins, just as vallAla sena (West bengal) is associated with the rADh.i and vArendrI brahmins; and given that the early part of our genealogy conflicts with the traditional stories; the most likely explanation is that the stories involved have gotten mixed up.

Furthermore, 22 generations later, today, it is 1999. So, if the traditional association with vallAla sena is correct, as vallAla sena ruled in the third quarter of the 12th century AD this would say that there were about 2.6 generations per century, or about 37 years per generation on the average. This is actually quite unlikely: A number between 25 years to 30 years per generation is what is usually considered reasonable, and I would expect 17 and 35 to be outer limits for an average over this length of time. If veda-garbha instead was during Adishura (during whose time, according to one story, brahmins are supposed to have come to Bengal), we get 29-30 years if he was in 999 shAka year (see next paragraph). This is to be compared against a 1937 study showing that in the bengali kulina brAhmaNa and kAYastha families, the average male to first male child generation time was then about 27 years. In addition, one should note that if indeed the Ramachandra mentioned in our genealogy is the same as Raja Ramchandra of Bakla, then again we find a count of about 35 years per generation. This, of course, is not the time to the first child: in this period, it was, on average, the time to the second son, but, even then, it is longer than the expected 30–32 years. Given that we were not kulins, and possibly consequently, not too much polygamy or childhood marriages, may be the family is indeed atypical in its long generation time.

On the other hand, it is true that our (my fathers's side, that is) family still does not have a guru family (we take dikSA from other members of the family). Also, most brahmin traditional stories in bengal claim to originate during either vallAla sena (the brahmins in this story actually came during AdishUra's time; tradition attributes the year 999 to this event. Unfortunately, it is not clear whether that is meant to be the shaka or samvat era) or shyAmala-varmA (these brahmins claim they came during his reign). It is in this context that the 12th century reference to a person of our gotra having come from outside is particularly interesting.

Similarly, the generation number is also unlikely to be incorrect. Because of the marriage rules only people with the same generation number could marry each other, and it was very important t get the generation number right. In fact, a 1937 study showed that the generation numbers of bengalee kulina kAYastha between 20 to 30 years old clustered between 26 and 29, with some outliers as low as 23 and as high as 30.

Historically, the gotra to which my father's family belongs (sAvarNa) is mentioned in the 12th century: bhoja-varmA of varmana dynasty gave land in paunDra-bhukti to a brahmin rAma-deva of sAvarNa gotra with pra-varas bhRgu, cyAvaNa, ApluvAna, aurva, jAmadagni, who was of vAja-saneya caraNa of the yajurvedIYa kANvashAkha, who was a shantyAgArika, and whose ancestors had come from madhya-desha to siddhala village in northern rADh.a. siddhala village was known to have many sAvarNa brahmins also during varmana king hari-barmA. It is to be noted that almost the same pra-varas (jAma-dagnya instead of jAma-dagni) is also attested for a family (ratnAkara to rahaskara to bhAskara to udayakara) from madhya-desha of vatsa gotra of AshvalAyana shAkha of Rgveda during vijaya-sena's rule.

During hindu marriage, exogamy rules prescribe that the bride and the groom have to recite the names of their direct ancestors of their father and mother along the male line for seven generations and the female line for five generations. This tradition is mentioned in sambandha viveka composed by bhava-deva bhaTTa. So, at whatever point the genealogy was written down, seven generations up from that point are likely to be correct. From the first appearance of details about village etc., and assuming that a person is likely to remember details of his grandfather, and possibly great grandfather, it is reasonable to conclude that 21. rAma-jIvana was one of the people who wrote down the genealogy. This would imply that, barring deliberate falsification and copying errors, starting at 14. vatsa, one can start trusting the genealogy as historical fact.

I should also note that 1. veda-garbha through 9. rashmi-kara is attested by the traditional stories of origin of Brahmin in Bengal: and it would make sense for myths of origin from this family to occur; though our genealogy actually disagrees with the traditional one, probably by the usual confusion of cousins being counted as on the direct line. That 14. vatsa to 17. jana-mejaYa is missing from one of the lists needs further investigation.

On my mother's side, the Nalchira village appears in the beautiful compilation of stories of abandoned villages ‘ছেড়ে আসা গ্রাম’ (Chhere Asha Gram) compiled and edited by Dakshinaranjan Basu. I haven't been able to locate the book, but it mentions a ‘world-conquering’ ‘Jagannath Tarkapanchanan’ that lived there. Whether this person was related in some way to the 5. Jagannath Panchanan that appears in our genealogy needs further investigation. The famous Jagannath Tarkapanchanan who wrote the hindu texts, was at the court of Krishnachandra Roy of Nadia/Krishnanagar, lived 1694–1807, and was a resident of Triveni, so he must be a different person.

Timing estimates

As mentioned above, the spread in generation numbers currently is about 10%. Assuming this was the case in the past (The times are short enough that I am ignoring the averaging effect which makes the percentage spread fall off as the square root of the mean number of generations), and assuming the minimum and maximum average generation times are roughly 29 and 40 years respectively (see above), we get the following approximate table for my father's family (for the early parts, I have used the constraints that vallAla sena of the 12th century made some people of generations 8–11 kulinas). Note that the spread in the generation numbers in this family is somewhat smaller, and prefer the generation numbers near the middle of the indicated range.

Translation between date of birth and generation number in my father's family. Note that generation time is not really constant, and hence knowing the generation number gives only a very vague indication of the century someone lived in. Thus, someone with generation number 23 may have been born in late 17th century, in 18th or 19th century, or even early 20th century. In our family the lower and upper ends of the ranges are taken rarely, thus generation 23 very likely lived in the 18th century.
Approximate time of birthGeneration range Approximate time of birthGeneration range Approximate time of birthGeneration range
21st century25–38 20th century23–35 19th century21–31
18th century18–28 17th century16–24 16th century13–21
15th century11–18 14th century 8–14 13th century 6–13
12th century 4–12 11th century 2–8 10th century 1–4

A similar calculation for my mother's family gives the following table:

Translation between date of birth and generation number in my mother's family. Note that these are meant to be indicative only: the actual generation time was certainly more variable.
Approximate time of birthGeneration range Approximate time of birthGeneration range Approximate time of birthGeneration range
21st century17–20 20th century14–17 19th century11–14
18th century 7–10 17th century 4–7 16th century 1–4

Deep ancestry from genetic evidence

If we go back even a couple of thousand years, each of us had innumerable ancestors living around the world: two of these were however special in our ability to know about them. They are the unique male at that moment of time who is connected to us by an unbroken chain of male descendants (i.e. my father's father's .... a hundred times over ... father) and the unique female an unbroken chain of whose daughters bore me (i.e. my mother's mother's ... a hundred times over ... mother). It is reasonable to assume that these two did not know each other, or may even not have known about the existence of each other's clan, or, indeed, race. In my case, a matrilineal ancestor could have been one of the original modern human inhabitants of India, whereas a patrilineal ancestor may have belonged to the tribes who spread out from around Ukraine, carrying with them the Indoeuropean language which ultimately gave rise to most of the European, Iranian, and North Indian languages. I describe this genetic story below.

Human Genetics

Our chromosomes come in pairs we inherit from our two parents. Similarly, each of our children obtains from us one chromosome corresponding to each pair. The chromosome we give to our child is, however, neither of the ones we got from our parents: Before we pass it to our child, we combine pieces from the chromosomes that we got from each parent in a process called recombination. Thus, some of the DNA in the chromosome that my child will get from me will have been my father, and some other bits from my mother. After a few generations, each bit of my descendants' DNA will have had a different origin, making it difficult to trace the ancestry except in a statistical sense.

There are however two exceptions to this. The mitochondrial DNA that we inherit only from our mothers is passed on unchanged, except for small ‘errors’: there has been occasional claim of past recombination, but current evidence is strongly against it. The same happens to most of the DNA in the Y chromosome which is carried in one copy by the males, except for a tiny region, it can no longer recombine with the X chromosome. The genealogy of the mtDNA is, thus, the genealogy along the female ancestral line (i.e. mother, mother's mother, and so on), whereas the Y chromosome traces the male ancestral line.

Of course, one needs to be careful! The rate of error is such that every change in our chromosomes (including the sex chromosomes) can happen about 1-10 times in every billion births (10-9–10-8 per position per generation) and about 200 times more often for the mtDNA (10 times that in the hypervariable regions usually tested). In other words, in the history of humanity, each marker could have arisen hundreds of times independently, and, with today's population, even in one generation there may be a few people who newly got that marker. A pair of markers, on the other hand, is very unlikely to have originated independently even once in the history of humanity, and when we see a shared pair, we can deduce that a genealogical connection was responsible for at least one of the markers. The slow mutation rate means that the common ancestor may have been a long time back; conversely, since the probability of a marker changing back is also negligible, very old ancestral relations are still visible in these studies.

The above mathematics applies to the base-substitution markers: there are also microsattelite (or minisattelite) studies, and the STR analysis described below (for Y-chromosomes) falls into this class. These change much faster (see here for example): about one to ten in a thousand births change the same marker by chance (See here for example; and here for a nice table and analysis of the common cases), but there are many more values each marker can take. As a result, one needs to be careful that back mutations become a significant possibility in 5000 to 10000 years in every lineage, and the same mutation happening in two lineages is already likely in half that time. At time depths of hundreds of thousands of years, i.e. in the entire history of humanity, the method needs care: differences smaller than some 5 mutation steps at any one position are almost completely uninformative; but because of the same fast mutations and multiple states, exact matches on many markers are rare by chance and imply shared ancestors much closer to us. As an example, assuming mutation probability of 2 in a thousand per generation per site, a very conservative estimate, the probability that at least one out of a random bunch of 12 of these markers changes within 14 generations is just under 30%, so there is just over 50% probability that two samples which match in these 12 markers exactly are from people more than 14 generations from a common ancestor. In a similar fashion, one can be 95% certain that there are no more than 62 generations to a common ancestor in this case.

Actually, what is an easier number to understand is the (95%) confidence interval: which is a range rather than a limit: for a twelve marker match, this is 1–77. Now, if we account for the fact that the markers might match because of similar or compensating changes, the quoted generation numbers become 15, 71, and 1–89 respectively. Since, as discussed before, a generation time is likely to be about 25 years, a twelve marker match means that there is about a 95% probability that the last common ancestor was around the beginning of the common era. But note that even then there were enough people so that the 5% probability event must have happened: i.e. occasionally one must find people whose common ancestor is much earlier or later than what this analysis suggests.

Some people would estimate using a much higher rate, and get half the number of generations as these, e.g., the 95% CI is quoted between 1–38 or 1–45 depending on the model used. The page dealing with DNA analysis at the Blair genealogy project gives an informative table of these numbers; and the site used by Family Tree DNA gives a detailed discussion and graphs.

All of the above assume that the markers have been chosen at random. This is obviously not true: the markers are chosen by researchers on the basis of the observed variation being useful in determining population structures. This could bias the calculations towards finding dates closer to the time that various previously defined populations separated, but the amount of bias cannot be judged. On a similar note, the effects of small populations, and, what turns out to be very similar, effects of extreme differences in the number of descendants various individuals have, is also ignored.

Y chromosome genetic evidence

The National Geographic genographic project analyzed my Y chromosome. Augmented with further tests I paid for, the following copy numbers of Short Tandem Repeats at various positions were found:

DYS39339019/394391385a*385b*
value132516111114
rate0.29–1.721.47–3.621.55–3.67 1.83–4.181.41–2.98F
DYS426388439*389-1392389-2
value121210141132
rate4.19–9.22 1.41–3.740.12–1.172.24–5.02
DYS458*459a459b455454447
value171010111124
rateFFF
DYS437448449*464a*464b*464c*
value142032151516
rateFFFF
DYS464d*460GATAH4YCAIIaYCAIIb456*
value161212192315
rateFF
DYS607576*570*CDYa*CDYb*442
value161918364214
rateFFFF
DYS438
value11
rate0.06–1.69
The 95% confidence interval on the estimate of the rates are from a summary web page and are in change per 1000 generations. Those marked with F are unknown, but are probably faster than the nominal rate of 2 per 1000 generations. The ones marked with * in the name are sometimes discounted as being fast. A paper parameterizes the mutation rates by: 3.1×10-6 × e0.200 ×M - 1.06 × |δ| for increase, and 4×10-7 × e0.302×M - 1.06 × |δ| for decrease, by δ from the marker value of M. A nomenclature change adjusted by 1 downward all the 464x on May 19, 2003: the values here are in the new scheme. The 389-2 nomenclature used here is the length of the entire 389 region including 389-1.

Obviously a difference in a slower mutating site like 392 could count as much as 14 times a mutation at a faster moving site like 439, but I ignore that in the following discussion.

According to Family Tree DNA site, no one with this exact profile has been tested by them yet. An ancient DNA from a Siberian mummy more than 3000 years back is, however, a 12 marker match for me. 12 marker matches (the first 12) has been seen in 1.5% of people represented in the YSearch database originating from Kazakstan (1/66; 95% exact binomial confidence interval on percentage [0.07,8]), 0.9% from Pakistan (1/108; [0.02,5]), 0.8% from Russian Federation (19 Altai(Siberian)+1 Kirghiz / 2357; [0.5,1.3]), 0.3% from Slovakia (1/367; [0.007,1.5]) and India (3/1107; [0.05,0.8]), 0.2% from Greece (1/534; [0.005,1]) and Mongolia (1/575; [0.004,1]), 0.1% from Hungary (1/786; [0.003,0.7]) and Ukraine (1/1049; [0.002,0.5]), and a sprinkling from Scotland (1/7719; [0.0003,0.07]), Germany (1/8388; [0.0003,0.07]), England (2/17101; [0.001,0.04]), and Ireland (1/9618; [0.0002,0.06]). The confidence interval in each case reflects the effect of only a small number of people having been tested: thus, if the true percentage of people of Russian origin who are a 12/12 match for me is outside the range 0.5–1.3%, the chance of seeing a large enough sampling fluctuation that we observe 20 matches out of 2357 randomly chosen people from a large population of Russians would be less than 5%. But, the actual population tested is not a random sample: the majority of the Siberian matches may have been from the Mendur-Sokkon village in the Ust'-Kanskii region in the southern part of the Altai republic. Similarly, people who got tested may be related in socio-economic and geneological ways: for example, the population from India that is tested may be skewed towards the group that resides in the US today. In addition, people report their origin in idiosyncratic way: so while some Englishmen report it as England, others will call themselves from the UK. Finally, with itinerant groups like gypsys, the country of origin is not a stable marker over long periods. The numbers here should, therefore, be interpreted cautiously.

At distance one, we find 7% from Kyrgyzstan (1/14; [0.2,33]), 4% from Slovenia (4/101; [1,10]), 2.8% from Pakistan (3/108; [0.6,8]), 2.2% from Slovakia (8/367; [0.9,4]), 1.5% from India (17/1107; [0.9,2]) and Iceland (2/135; [0.2,5]), 1.2% from Bulgaria (1/84; [0.03,6]) and Canada (2/170; [0.1,4]), 0.8% from Norway(8/952; [0.4,1.6]), 0.7% from Denmark (4/587; [0.2,1.7]), Russian Federation (12 Altai(Siberan) + 4 others / 2357; [0.4,1.1]), Syrian Arab Republic (1 Arab/152; [0.02,4]), and Uzbekistan (1/152; [0.02,4]), 0.6% from Lebanon (1/154; [0.02,4]), Hungary (5/786; [0.2,1.5]), Lithuania (1 Askenazi-Levite + 3 others / 699; [0.2,1.5]), Greece (3/534; [0.1,1.6]), and Poland (1 Prussia + 13 others/2535; [0.3,0.9]), 0.5% from Austria (2/389; [0.06,1.8]), 0.4% from Ukraine (4/1049; [0.1,1.0]), 0.3% from Mongolia (2/575; [0.04,1.3]) and Czeck Republic (1/385; [0.007,1.4]), 0.2% from Germany (15/8388; [0.1,0.3]), Sweden (2/1213; [0.02,0.6]), and Italy (4/2479; [0.04,0.4]), 0.1% from China (1 Chinese Ethnic Minority/897; [0.003,0.6]) and United Kingdom (1 Great Britain, 1 Shetland Islands and 2 ohers / 7722; [0.01,0.1]), and a sprinkling from Spain (1/2292; [0.001,0.2]), Ireland (4/9618; [0.01,0.1]), Scotland (3/7719; [0.008,0.1]), and England (6/17101; [0.01,0.08]).

A small note on the timing issues for these matches: the previous calculations show, for example, that the chance is less than 5% that descendants of two brothers will have a 12 marker match 62 generations later. But, if enough of those descendants all do their DNA tests, then it is almst certain that some matches will be found. So, once we search a large database like this, we may often find ancestries deeper than the calculations naïvely suggest, and the last common ancestor with many of these people may have lived longer in the past.

The security modal haplotype (i.e. the ‘catch all’) of the modal R1a haplotypes listed by the Scandinavian Y-DNA project is close (1 difference in 14 markers carefully chosen to represent R1a). I am almost equally distant to the specific modal haplotypes: the Eastern European one is closest at a distance 20/37, and the rest are at distances of 21/37 (English, Eurasian, and Old Norse) or 22/37 (Ashkenazi-Levite). A naïve calculation indicates the last common ancestor was between 5 and 159 generations back, at 99% confidence; but since these are not random sequences, rather they were chosen because they are modal, the estimates may be skewed.

The following is from older information: 12/12 matches were found in Austria-Hungary(1/151), Greece (1/312), Hungary (1/385), India (3/793), Ireland (1/5460), Kazakhstan (1/38), Mongolia (1/574), Pakistan (1/66), Russia (19 Siberia/Altai + 1 Kirghiz out of 1827), Scotland (1/4382), Slovakia (1/221) and Ukraine (1/558). One each from Austria-Hungary, India, Mongolia, and 3 of unknown origin, and all 20 from Russia had their haplogroup determined to be R1a by an SNP test.

Matches at distance one (95% CI for last common ancestor of 5–121 or 6–148 generations depending on the model and assuming the slow mutation rate) are from Austria-Hungary (1/151), Bulgaria (1/30), China (1* chinese ethnic minority/677), Czechoslovakia (1/130), Denmark(1**+2/335), England (2/10167), Germany (1*+1**+8/4628), Greece (3/312), Hungary (1/385), Iceland (1*+1**/130), India (6*+1**+5/793), Ireland (1/5460), Italy (2/1140), Kyrgyzstan (1*/10), Mongolia (2*/574), Norway (1*+2/511), Pakistan (1/66), Poland (5/1170), Prussia (1/159), Russia (1*+1+12* Altai(Siberian)/1827), Scotland (1*+1/4382), Shetland (1/141), Slovakia (1**+6/221), Slovenia (1/46), Sweden (1/680), Syrian Arab (1*/129), Ukraine (2/558), United Kingdom (1/3405), United States (1/555), and Uzbekistan (1*/147). The asterisked numbers (and 2 of unknown origin) in each case had their haplogroup confirmed as R1a (** is R1a1) by an SNP test. Some details about more distant matches are here.

I have managed to communicate with five of the sixteen families with exact matches to the 12 markers still listed on the FtDNA site:

I have not been able to contact

I have not yet tried to contact

A match at distance 1/12 happens with Harish Radhakrishna Kamath, with the most distant known paternal ancestor is Raghavendra Kamath 1913–1989 from Karkal. The Kamath family, who are a Gaura Saraswat Brahmin family from Mangalore whose family tradition says they moved from Kashmir to Trihotapura in Bengal and around 500 AD moved to Goa from whence they moved to Mangalore after the Portuguese started administering that region. A 37 marker test shows that there are 12 markers which are different, and the total difference is 22 in the stepwise mutation sense; but since all except one of the multiple differences is at faster varying sites, the relevant result is probably that 14–15 mutations in 37 generations has a 95% confidence interval of between 10 and 125 generations without convergent or back mutation correction, not correcting for the fact that the match was found by the search of a large database. Nine other families: Onus (Curtis), Houghton (Christopher), Hallal (Julian), Bergtun (Dag Harald; most distant Knut Eriksen Rakvåg,b.c. 1695,Rakvåg,Oterøy,Norway), Runnells (Martin George), Psaltopoulos (Dimitrios Vassilios; most distant Lazaros Psaltoglou from northern Turkey) , Larsen (Kurt P.; most distant Lars Nielsen of Hjørring Amt, Denmark), Dibek (Mithat; most distant from Bulgaristan) and Fox (Stephen Lynn; most distant Gottlieb Dec 1846–19 Jul 1903 from Germany) also appear at a distance of 1/12; many people at much closer distances also appear in the ySearch database.

From the markers, I was classified as a R1a(M17) individual and I was classified as belonging to haplogroup R1a1(xR1a1a/b/c) by SNP typing (M124- M157- M269- M343- M56- M64.2-? M87- P25- SRY10831.2- M17+ M173+ M198+ M207+), just like 72% of the West Bengal Brahmins: see here for a basic idea of how a Single Nucleotide Polymorphism test works. As shown in this diagram, before the cladistic nomenclature started, it has been variously named as belonging to haplogroup 3, IX, 1D, 45, Eu19, H16, or D, according to classification systems adopted by various authors. The history of this haplotype is as follows. Note that the numbers that follow are all approximate, and I haven't gone back to the sources to find the error bars. Also, here I present only the lineage that leads to me, a summary of other lineages which populated India can be found in my pages dealing with the history of Bengal. In a similar vein, this description only traces back to at most a 100000 years back, you can find a cursory account of human evolution dealing with the period before that here instead.

As the Y chromosome is passed on, small ‘mutations’ or copying errors (given names like M17; here is an incomplete list) occur, dividing all of us into haplogroups (e.g. R1a) who share male ancestry. The deepest split is when the A haplogroup split away around 55000 years back (to within large errors), after which my ancestors accumulated the markers SRY10831.1, M42, M94, and M139. This was followed by the appearance of the markers M168 and P9 after splitting from people carrying the haplogroup B. The first individuals in whom these mutation occurred fathered all individuals living outside Africa, and is fondly called the Eurasian Adam. All we know so far is he lived sometime between 29000 and 77000 B.C. in Africa, some 2000 generations, give or take a 1000, before me; and his descendants had a wanderlust, possibly nomadically following the animals during a period of moist climate, or possibly driven by a population increase resulting from the favourable climate. Whatever be the reason, we see an increasing sophistication in tools and appearance of art as the generations progressed.

After a wave of emigrants left to populate the southern coast of Asia all the way to Australia, the markers P14, M89, and M213 made their appearance and we started being called the haplogroup F. Most non-Africans are actually the descendant of this individual (about 1500 generations back), who lived somewhere in northern Africa or the then grasslands of the middle east around 43000 B.C. His descendants went through Iran into the Steppes of Central Asia, possibly hunting game like buffalo, antelope, and wooly mammoths.

Some 5000 years later, and say 1200 generations back, a man living in Iran or southern Central Asia developed the marker M9 and all of us who descended from him are classified as haplogroup K (the descendants of the other haplotype F people are today called F*(xK), and so on for the other cases below). His descendants are popularly called the Eurasian clan, and are a vast majority in Asia, Europe, and the Americas.

The next major set of markers M45, M74, P27, 92R7, and P63(?) marked us as belonging to haplogroup P. These mutations arose from the Pamir region amongst the Eurasian clan about 35000 BC, still more than a 1000 generations before us. His descendants started in the game rich regions north of the Hindukush, but ultimately populated most of Europe and the Americas; even while surviving the ice age that was upon them.

The appearance of M207 then made us into group R, and M173 made it R1 (R2, the other defined haplogroup is marked by M124 instead). These arose on the westward journey of the descendants of the haplogroup P individuals. In a simplistic way, one can theorize that it is the descendants of these people who brought cave paintings to Europe, but our ancestors turned back east crossing back to Asia north of the Caspian sea. Reality, of course, could be more complicated if, as is likely, appreciable diffusion and incorporation of outsiders was taking place in those days, and any migrating group would be genetically heterogeneous to some extent. See the genebase tutorial for a more detailed writeup by them.

A further mutation, SRY10831.2, (actually reverting back to the SRY10831- state it had in the A haplogroup) marks us as belonging to group R1a (M343 is the marker for R1b, P25 for R1b1, and M269 for R1b1c: all tested negative for me), and my DNA also contains the markers M17 and M198 meaning I belong to R1a1. I however do not have the markers M56 for R1a1a, M157 for R1a1b, nor M64.2 and M87 for R1a1c, and currently am classified as the undifferentiated R1a1*. The R1a1 group probably arose about 20 thousand years ago around the Hindukush mountains (or in Pakistan), but a major population may have moved north and started spreading out about 10–15 thousand years, or say 400 to 600 generations, back from somewhere possibly around Ukraine or southern Russia. There is some reason to believe that these were the ancestors of the people who spread the Indoeuropean group of languages around the world, and possibly the Steppes people that domesticated the horse. Of course, if, as seems likely, the R1a haplotype arose thousands of years before the origin of the Indoeuropean group of languages, it may have been present indigenously in various places including India before the advent of Indoeuropean speaking people. Conversely, this late in human history in such a populated region, the amount of linguistic conversion and cultural adoption is expected to be great enough that the people speaking predominantly Indoeuropean languages could often harbour a mixture of haplogroups, and ‘Indoeuropean migrations’ in various regions could even be predominantly represented by different haplotypes. In fact, recent work published shows that the history of the R1a1 people is probably far more complicated than a simple migration of Indoeuropean people either to or from India.

In November 2007, a paper was published that reported sequencing results on DNA extracted from ancient Siberian mummies from the Krasnoyarsk region. Those from the Andronovo culture (2300–1000 BC), often associated with the Indo-Iranian innovations, had (this is not in the paper: it was reported in a discussion forum)

     DYS 19:16 385a:11 385b:14 389I:14 389II:32 390:25
         391:11 392:11 393:13 437:14 438:11 439:10
which is an exact match for me. In a single lineage (as opposed to two lineages we were calculating before), the chance of perfect preservation of 12 arbitrary markers in these intervening 3500 or so years, or 125 or so generations, is about 5%. Four samples from the Tagar culture were different at 1, 3, 4, and 5 positions, whereas the one sample from Tachtyk culture was different at four places. No data was available from the Afanassievo culture. Another study that looked at later Mongolian mummies from the Xiongnu period (3rd century BC–2nd century AD) found at least one (Egyin Gol #70) which had only 1/10 differences (in the fast moving 389) (19:16, 390:25, 391:11, 392:11, 393:13, YCAII:19/23, 385:11/14, 389II:31) from me. (#72 and #73 couldn't be determined and #65 might be distantly related.)

Given this data, we cannot be certain which wave of people my ancestors came into India with, but the fact that a large number of close matches (i.e., close enough such that the last common ancestor may be about a couple of millenia) in the Kazakhstan-Siberian region suggests a late migration. It is possible that our ancestors reached the Krasnoyarsk region-Egiin Gol valley about three and a half thousand years back, then moved to the Amaty-Ili valley region at some point, and a branch moved out of there around the time of Christ and came to India. In fact, at least two historical migrations from that region, all the way to Transoxiana and Bactria and into India right around 2000 years back is known: the Yuezhi (月支) (possibly the same as the Tocharians) who were thrown out northwestward out of their homeland, possibly near the Tarim basin-Gansu region, in northwestern China by the Xiongnu around 177 BC, after settling in the Ili valley and forcing the Sakas settled around Issyk-Kul to move southwards to Bactria and India (Shakas, possibly related to the horse people, Kambojas), were themselves forced to move south by the Uysyns/Wusuns by about 155BC. They finally reached India through Transoxiana and Bactria by the first century AD, posibly earlier, at a time when the Guishuang (貴霜) tribe amongst them was in control, and were called Kushanas (possibly related to Rishikas) in later history here. The concentration in Poland-Slovakia region, and in Germany, is probably not due to the Gypsy movement out of India around a thousand to fifteen hundred years back since R1a is rather rare in the Romani populations today, but probably to the movement related to the settlement of Sakas Taradarya of the Darian insciptions. The Viking spread of R1a1 is also supposed to originate in the same Russian steppe region.

mtDNA genetic evidence

The hypervariable region 1 of my mtDNA was sequenced and found to differ from the cambridge reference sequence

16001 ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCA
      CCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAAT
      ACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTA
      CAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCA
      ACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAA
      ATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCA
      ATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTG
      TATCCGACATCTGGTTCCTACTTCAGGGTCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGAC
      ATCACGATG 16569

by transitions at the five marked positions: T16093C (i.e. I have C instead of T), G16129A, C16223T, T16519C, and C16527T. An exact match to this entire region would mean, with 95% certainty, that the last common ancestor along the female line lived after the beginning of the Indus valley (or Saraswati-Sindhu) civilization. No such match is there in the database, but the positions 16401 to 16568 are not tested as often. There are three matches found in the first 400 positions alone (1/2342 from Ireland and 2/1792 from United Kingdom ), but they may be from the I haplotype, a N* descendant, instead of being closely related. 1/143 match from India is indeed M*. A Radhabai Subramanian born around 1920 in India differs in not having the 093C mutation only, and is the closest person whose details were available, I have not been able to contact her.

A similar test of the second hypervariable region showed differences, at the marked positions, from the CRS:

1  GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGG
   GTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTC
   CTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTA
   ATTAATTAATGCTTGTAGGACATAATAATAACAATTGAATGTCTGCACAGCCACTTTCCACACAGACATC
   ATAACAAAAAATTTCCACCAAACCCCCCCTCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCA
   AACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTTGGCGGTATGCAC
   TTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTAATCTCATCAATA
   CAACCCCCGCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCAACCAAACCCC
   AAAGACACCCCCCA 574

by transitions A73G, A93G, A263G, and T489C and by an insertion —315.1C.

The genetic markers classify me as coming from the M* stock. The story of this group (see here for the groups) is as follows: About 80000 years ago, the African haplogroup L3 arose somewhere in Northern Africa. Its daughters, M* first and then N*, were the first to leave Africa. M* gave rise to M1 in Northern Africa or Arabia, and then C, D, and Z around 60000 years back, somewhere possibly around Persia. The daughters of these populated large parts of east Asia and the Americas, but M* itself spread out to the Indian subcontinent, possible along the coastal Persia and Afganisthan; and then went on to Southern and Southeast Asia. The Indian variety (16223T; the mutation is also seen in a Mongolian mummy from around the beginning of Christian era in this study), to which I belong, may have arisen 48000 years ago, give or take a couple of thousand years. The 16093C mutation arose in this population and is present in more than 7% of those belonging to M* in India. In general, the haplogroup M is common among the ancient tribal populations of India, and rarer among the higher castes. Look here for a history of the various haplogroups of mtDNA and for distribution of these groups in the Indian population.

You are visitor number Image of the counter since I started counting.

Valid HTML 4.0! Valid CSS!